urod

Ensembl ID:
ENSDARG00000006818
ZFIN ID:
ZDB-GENE-000208-18
Description:
Uroporphyrinogen decarboxylase [Source:UniProtKB/Swiss-Prot;Acc:Q9PTS2]
Human Orthologue:
UROD
Human Description:
uroporphyrinogen decarboxylase [Source:HGNC Symbol;Acc:12591]
Mouse Orthologue:
Urod
Mouse Description:
uroporphyrinogen decarboxylase Gene [Source:MGI Symbol;Acc:MGI:98916]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19778 Nonsense Available for shipment Available now
sa19777 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19778
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014568 Nonsense 245 369 7 10
Genomic Location:
Chromosome 2 (position 27710662)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGGAGTTTAAAGAGTTTTCTCTGCCGTATCTGAGAGACATTGCTCGA[C/T]GAGTTAAAGACAAGATCAAAGAATCTGGTTTAGACAATGTGCCTATGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19777
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014568 Nonsense 327 369 10 10
Genomic Location:
Chromosome 2 (position 27704506)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGTTGATGTGTTATCAGGAGAGCATCTCTGAGATCGTGAGGAGGATGT[T/A]GGAGGGCTTTGGCACAAAGGGCTACATCGCTAATCTGGGTCACGGCCTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6s1eb4z6