gtf2f2b

Ensembl ID:
ENSDARG00000006816
ZFIN ID:
ZDB-GENE-050417-374
Description:
novel protein similar to H.sapiens GTF2F2, general transcription factor IIF, polypeptide 2, 30kDa (G
Human Orthologue:
GTF2F2
Human Description:
general transcription factor IIF, polypeptide 2, 30kDa [Source:HGNC Symbol;Acc:4653]
Mouse Orthologue:
Gtf2f2
Mouse Description:
general transcription factor IIF, polypeptide 2 Gene [Source:MGI Symbol;Acc:MGI:1915955]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41391 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41391
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006514 Essential Splice Site 48 256 2 8
Genomic Location (Zv9):
Chromosome 9 (position 19451664)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 18825906
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGCAAAAGCATCTGGGCGAGGAGAAGTAGGCAAGCTTAAAATTGGGAA[G/A]TATGGCCTATTTTAAAACCTCAGTTGAAACGGACATTTAATTAAATTTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link