si:ch211-153j24.6

Ensembl ID:
ENSDARG00000006812
ZFIN ID:
ZDB-GENE-041014-277
Description:
WD repeat-containing protein 26 [Source:UniProtKB/Swiss-Prot;Acc:Q5SP67]
Human Orthologue:
WDR26
Human Description:
WD repeat domain 26 [Source:HGNC Symbol;Acc:21208]
Mouse Orthologue:
Wdr26
Mouse Description:
WD repeat domain 26 Gene [Source:MGI Symbol;Acc:MGI:1923825]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23806 Essential Splice Site Available for shipment Available now
sa37155 Essential Splice Site Mutation detected in F1 DNA During 2017
sa9037 Nonsense Mutation detected in F1 DNA During 2017
sa43528 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23806
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029894 Essential Splice Site 102 576 2 14
Genomic Location (Zv9):
Chromosome 20 (position 46954751)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 46800034
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAGCCACAAAGTTTCGAAACCACGTCATGGAAGGTGAATGGGACAAGG[T/G]GAGGATTCTCAATCCATACGCAACTTGCATGTAAAGCAGAAAACATTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37155
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029894 Essential Splice Site 167 576 4 14
Genomic Location (Zv9):
Chromosome 20 (position 46963869)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 46809152
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTGACTCCCCTCAAATACAACACGGATCGAATCCATGTGCTCAGCGGG[T/A]ACTAAACAGCACGCATTAACATGCTTTATTAAAACATGCATTACTGATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9037
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029894 Nonsense 192 576 5 14
Genomic Location (Zv9):
Chromosome 20 (position 46964061)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 46809344
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATCTGAAGGCAAAGGCTGAGTGGGAGGGAAAAGGAGCTGGATCACGATG[T/A]AGATTATTGGACAAGCTCCAGAGTGAGTATNNNAAAAACGMACACATGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43528
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029894 Nonsense 404 576 10 14
Genomic Location (Zv9):
Chromosome 20 (position 46972033)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 46817316
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGGGAATCTGCTGGAGTCATGGGAAGGTGTTCGTGTGCAGTGTCTGTG[G/A]TGTATGGGCGACGGACGGACGGTCCTGGCCTCTGATACACACCAGCGGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link