si:dkey-121j17.1

Ensembl ID:
ENSDARG00000006797
ZFIN ID:
ZDB-GENE-030131-8274
Description:
5'-nucleotidase domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_001098413]
Human Orthologue:
NT5DC1
Human Description:
5'-nucleotidase domain containing 1 [Source:HGNC Symbol;Acc:21556]
Mouse Orthologue:
Nt5dc1
Mouse Description:
5'-nucleotidase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2442446]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17741 Nonsense Available for shipment Available now
sa12281 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17741
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026794 Nonsense 107 461 4 12
ENSDART00000138585   None 278 None 6
Genomic Location (Zv9):
Chromosome 20 (position 497687)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 491471
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACGAAAAACCTGAGCACAGATGAMATCGTAAAGCATTACGGCCCAAAG[C/T]GAGAATGGAAGCATTTTAATAGCCTCAATACTTCGTACACTCGATCTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12281
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026794 Nonsense 368 461 10 12
ENSDART00000138585 Nonsense 185 278 4 6
Genomic Location (Zv9):
Chromosome 20 (position 542620)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 535895
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAACAGCAGCAGTGGCGGCCCGAGCGAAGGGCCGGTGGAGAAAAAGGCC[A/T]AGTTTGAGGTGAGACTGAAAAAGCTCTTTCGGTTTAGCCAAGCTCRGGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link