si:dkey-121j17.1

Ensembl ID:
ENSDARG00000006797
ZFIN ID:
ZDB-GENE-030131-8274
Description:
5'-nucleotidase domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_001098413]
Human Orthologue:
NT5DC1
Human Description:
5'-nucleotidase domain containing 1 [Source:HGNC Symbol;Acc:21556]
Mouse Orthologue:
Nt5dc1
Mouse Description:
5'-nucleotidase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2442446]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17741 Nonsense Available for shipment Available now
sa44928 Essential Splice Site Mutation detected in F1 DNA During 2017
sa12281 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17741
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026794 Nonsense 107 461 4 12
ENSDART00000138585   None 278 None 6
Genomic Location (Zv9):
Chromosome 20 (position 497687)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 491471
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACGAAAAACCTGAGCACAGATGAMATCGTAAAGCATTACGGCCCAAAG[C/T]GAGAATGGAAGCATTTTAATAGCCTCAATACTTCGTACACTCGATCTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44928
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026794 Essential Splice Site 149 461 5 12
ENSDART00000138585   None 278 None 6
Genomic Location (Zv9):
Chromosome 20 (position 500123)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTGCCCGGCGCTCTTCTCTGTGCCAGAGTGGTGGACATGATGAATAAG[G/A]TAAAGCAGCTCATATCTAATGCAGATCAGAGGTGCTGTTTGTTAATTAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12281
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026794 Nonsense 368 461 10 12
ENSDART00000138585 Nonsense 185 278 4 6
Genomic Location (Zv9):
Chromosome 20 (position 542620)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 535895
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAACAGCAGCAGTGGCGGCCCGAGCGAAGGGCCGGTGGAGAAAAAGGCC[A/T]AGTTTGAGGTGAGACTGAAAAAGCTCTTTCGGTTTAGCCAAGCTCRGGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link