arntl1a

Ensembl ID:
ENSDARG00000006791
ZFIN ID:
ZDB-GENE-000509-1
Description:
aryl hydrocarbon receptor nuclear translocator-like 1a [Source:RefSeq peptide;Acc:NP_571652]
Human Orthologue:
ARNTL
Human Description:
aryl hydrocarbon receptor nuclear translocator-like [Source:HGNC Symbol;Acc:701]
Mouse Orthologue:
Arntl
Mouse Description:
aryl hydrocarbon receptor nuclear translocator-like Gene [Source:MGI Symbol;Acc:MGI:1096381]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38044 Essential Splice Site Mutation detected in F1 DNA During 2016
sa24645 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38044
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023959 Essential Splice Site None 626 2 19
Genomic Location (Zv9):
Chromosome 25 (position 18398104)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17814414
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGGAGAAAGGACATGCATTGATCACAGCTGCTTGAATGAATCTGTGCG[G/T]TGAGCTTCTATAGATGCACGTTGATATAACATCACACAGTGTGACCTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24645
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023959 Nonsense 130 626 7 19
Genomic Location (Zv9):
Chromosome 25 (position 18394361)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17810671
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGACAAACTCACAGTGCTTCGCATGGCTGTCCAACACATGAAGACATTA[C/T]GAGGTGAGAGCTTTCTGCCACAGCGCTGATTGAGCTCATTAAGAGCCCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link