copz2

Ensembl ID:
ENSDARG00000006786
ZFIN ID:
ZDB-GENE-000406-5
Description:
coatomer subunit zeta-2 [Source:RefSeq peptide;Acc:NP_571582]
Human Orthologue:
COPZ2
Human Description:
coatomer protein complex, subunit zeta 2 [Source:HGNC Symbol;Acc:19356]
Mouse Orthologue:
Copz2
Mouse Description:
coatomer protein complex, subunit zeta 2 Gene [Source:MGI Symbol;Acc:MGI:1929008]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6885 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19997 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6885
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002177 Essential Splice Site 71 199 None 11
ENSDART00000078615 Essential Splice Site 52 172 None 8
ENSDART00000131509 Essential Splice Site 53 173 None 9
ENSDART00000138270 Essential Splice Site 58 189 None 10

The following transcripts of ENSDARG00000006786 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 24388833)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAARAATTTTGAGAAGAACGTCTTCAACAAAACACACAAAGCTGACAG[T/C]AAGTCGATTATTTTATAGGCTCTGTGTTGCMTTTTAATCGGTATCCTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19997
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002177 Nonsense 92 199 5 11
ENSDART00000078615 Nonsense 73 172 3 8
ENSDART00000131509 Nonsense 74 173 4 9
ENSDART00000138270 Nonsense 79 189 4 10

The following transcripts of ENSDARG00000006786 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 24392002)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGAGGGAATGACGATAGTCTACAAGAGCAGCATAGACCTGTTCTTCTA[T/A]GTAGTCGGCAGCGCTCAGGAGAACGAGGTGAGTCCTGTATGCAGATGAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Epilepsy (generalized): Genome-wide association analysis of genetic generalized epilepsies implicates susceptibility loci at 1q43, 2p16.1, 2q22.3 and 17q21.32 (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/f3dxgtqw