CASS4

Ensembl ID:
ENSDARG00000006775
Description:
Cas scaffolding protein family member 4 [Source:HGNC Symbol;Acc:15878]
Human Orthologue:
CASS4
Human Description:
Cas scaffolding protein family member 4 [Source:HGNC Symbol;Acc:15878]
Mouse Orthologue:
Cass4
Mouse Description:
Cas scaffolding protein family member 4 Gene [Source:MGI Symbol;Acc:MGI:2444482]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31836 Nonsense Available for shipment Available now
sa35101 Nonsense Mutation detected in F1 DNA During 2016
sa14486 Nonsense Available for shipment Available now
sa17485 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31836
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023823 Nonsense 244 793 5 7
Genomic Location (Zv9):
Chromosome 11 (position 28628068)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 27504054
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGTGTGGTTATAGTACCATGCCAAATCCCTGTAAGTCGGAATGGATCTA[T/A]GACGTGCCTGTCTTTCCACAAAAACAGGGATGTGAACCTGGTTACTGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35101
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023823 Nonsense 566 793 5 7
Genomic Location (Zv9):
Chromosome 11 (position 28627104)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 27503090
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGCCATTCACAGATGCCTGATCACCTGGAACGCTTTGTTATGGTGGCT[C/T]GAACCGTGCCGGAGGATGTGAAGAGGCTGGTGTCCATGCTGAACGCGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14486
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023823 Nonsense 653 793 6 7
Genomic Location (Zv9):
Chromosome 11 (position 28623424)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 27499410
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCAAAACCAACCAAGAGCAGCATTAAATCAAAGAGAAACAGTGATTCCT[T/A]GAAAAAACAGGTATGAAAACGTAACTCTATTGTATTTGAACCTGAYATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17485
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023823 Nonsense 767 793 7 7
Genomic Location (Zv9):
Chromosome 11 (position 28623002)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 27498988
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAGCAACTAGCCTTGGTGACCAAGAAGGCGGCTTTGAACTTCCCTGAC[A/T]AACTGGCAGTCCAGGAGGCACATGACATTGCCAAAGAGYTRGCGCAAAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link