CASS4

Ensembl ID:
ENSDARG00000006775
Description:
Cas scaffolding protein family member 4 [Source:HGNC Symbol;Acc:15878]
Human Orthologue:
CASS4
Human Description:
Cas scaffolding protein family member 4 [Source:HGNC Symbol;Acc:15878]
Mouse Orthologue:
Cass4
Mouse Description:
Cas scaffolding protein family member 4 Gene [Source:MGI Symbol;Acc:MGI:2444482]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14486 Nonsense Available for shipment Available now
sa17485 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14486
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023823 Nonsense 653 793 6 7
Genomic Location:
Chromosome 11 (position 28623424)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCAAAACCAACCAAGAGCAGCATTAAATCAAAGAGAAACAGTGATTCCT[T/A]GAAAAAACAGGTATGAAAACGTAACTCTATTGTATTTGAACCTGAYATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17485
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023823 Nonsense 767 793 7 7
Genomic Location:
Chromosome 11 (position 28623002)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAGCAACTAGCCTTGGTGACCAAGAAGGCGGCTTTGAACTTCCCTGAC[A/T]AACTGGCAGTCCAGGAGGCACATGACATTGCCAAAGAGYTRGCGCAAAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4crq009t