kbtbd10b

Ensembl ID:
ENSDARG00000006757
ZFIN ID:
ZDB-GENE-030131-9875
Description:
kelch repeat and BTB (POZ) domain containing 10b [Source:RefSeq peptide;Acc:NP_945330]
Human Orthologue:
KBTBD10
Human Description:
kelch repeat and BTB (POZ) domain containing 10 [Source:HGNC Symbol;Acc:16905]
Mouse Orthologue:
Kbtbd10
Mouse Description:
kelch repeat and BTB (POZ) domain containing 10 Gene [Source:MGI Symbol;Acc:MGI:2683854]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26661 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26661
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013588 Essential Splice Site 520 605 4 6
Genomic Location (Zv9):
Chromosome 6 (position 3499069)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 3526344
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGACGGACTCACAGCTTTATCGGAAACCTATGATTTTGATACAAACAA[G/A]TATGAGCCTTCACCATTATTATTTTAGTATTGCACATAATATTTGAAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link