eif3s6ip

Ensembl ID:
ENSDARG00000006729
ZFIN IDs:
ZDB-GENE-040426-2138, ZDB-GENE-040426-2138
Description:
Eukaryotic translation initiation factor 3 subunit L [Source:UniProtKB/Swiss-Prot;Acc:Q7T2A5]
Human Orthologue:
EIF3L
Human Description:
eukaryotic translation initiation factor 3, subunit L [Source:HGNC Symbol;Acc:18138]
Mouse Orthologue:
Eif3l
Mouse Description:
eukaryotic translation initiation factor 3, subunit L Gene [Source:MGI Symbol;Acc:MGI:2386251]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42290 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42290
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099628 Nonsense 57 576 3 15
ENSDART00000130021 Nonsense 57 576 3 15
Genomic Location (Zv9):
Chromosome 13 (position 43900334)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 43115450
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCAGACTTACCACGTGATTCCCGAAGTCATAAAGAACTTCCTGCAGTA[T/A]TTCCATAAAACCATCTCAGACCTTATCGATCAGAAGGTTTACGAGCTGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link