pkn2

Ensembl ID:
ENSDARG00000006705
ZFIN ID:
ZDB-GENE-061207-42
Description:
Novel protein similar to vertebrate protein kinase N2 (PKN2) [Source:UniProtKB/TrEMBL;Acc:A2BIH5]
Human Orthologue:
PKN2
Human Description:
protein kinase N2 [Source:HGNC Symbol;Acc:9406]
Mouse Orthologue:
Pkn2
Mouse Description:
protein kinase N2 Gene [Source:MGI Symbol;Acc:MGI:109211]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19744 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19744
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089357 Essential Splice Site 806 983 20 24
ENSDART00000131763 Essential Splice Site 793 970 18 22
Genomic Location (Zv9):
Chromosome 2 (position 23073923)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 22815991
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACACTGAGGGATTTGTCAAGATTGCTGACTTCGGTCTTTGCAAAGAAGG[T/C]AAGGCTCTGTTTGCTGTTGGGTTAAGCTCTGTGTAAGCAGCAGACTCAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link