tmprss4a

Ensembl ID:
ENSDARG00000006693
ZFIN ID:
ZDB-GENE-061103-631
Description:
transmembrane protease, serine 4a [Source:RefSeq peptide;Acc:NP_001071206]
Human Orthologue:
TMPRSS4
Human Description:
transmembrane protease, serine 4 [Source:HGNC Symbol;Acc:11878]
Mouse Orthologue:
Tmprss4
Mouse Description:
transmembrane protease, serine 4 Gene [Source:MGI Symbol;Acc:MGI:2384877]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2830 Nonsense Mutation detected in F1 DNA During 2016
sa6366 Essential Splice Site Mutation detected in F1 DNA During 2016
sa32017 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa2830
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101301 Nonsense 153 430 6 13
ENSDART00000131290 Nonsense 153 154 6 6
ENSDART00000136238 Nonsense 210 309 6 9
Genomic Location:
Chromosome 15 (position 13010504)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGCATCGCAGTGGGTCCTTTGCCGTCTGATCTGAAGATRTCTTTCTG[C/A]ATGGTGGGCACAACCAAACCACAGACTTTCCAATCCGCTGTGTCAGATCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6366
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101301 Essential Splice Site 170 430 7 13
ENSDART00000131290   None 154 None 6
ENSDART00000136238 Essential Splice Site 227 309 7 9
Genomic Location:
Chromosome 15 (position 13010321)
KASP Assay ID:
554-5208.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTCATTATTCAGTTTGAKTGTAAACATTGTCATTTTTTTTTTTTTTTC[A/T]GTAAGGTATGCAGTACWGGAACTGTCATCTCATTATCATGCTCTGGTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32017
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101301 Nonsense 249 430 9 13
ENSDART00000131290   None 154 None 6
ENSDART00000136238 Nonsense 306 309 9 9
Genomic Location:
Chromosome 15 (position 13007516)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCACATTGTTGTGTGTTGTTTAGGGATGGCAGGAAAGCTCTGAGCCGGT[G/A]GACCGTCGTCTCAGGAATTACGTATCTGAGTTCTACTCCATCTTCATATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link