tmprss4a

Ensembl ID:
ENSDARG00000006693
ZFIN ID:
ZDB-GENE-061103-631
Description:
transmembrane protease, serine 4a [Source:RefSeq peptide;Acc:NP_001071206]
Human Orthologue:
TMPRSS4
Human Description:
transmembrane protease, serine 4 [Source:HGNC Symbol;Acc:11878]
Mouse Orthologue:
Tmprss4
Mouse Description:
transmembrane protease, serine 4 Gene [Source:MGI Symbol;Acc:MGI:2384877]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2830 Nonsense Mutation detected in F1 DNA During 2014
sa6366 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2830
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101301 Nonsense 153 430 6 13
ENSDART00000131290 Nonsense 153 154 6 6
ENSDART00000136238 Nonsense 210 309 6 9
Genomic Location:
Chromosome 15 (position 13010504)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGCATCGCAGTGGGTCCTTTGCCGTCTGATCTGAAGATRTCTTTCTG[C/A]ATGGTGGGCACAACCAAACCACAGACTTTCCAATCCGCTGTGTCAGATCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6366
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101301 Essential Splice Site 170 430 7 13
ENSDART00000131290 None None 154 None 6
ENSDART00000136238 Essential Splice Site 227 309 7 9
Genomic Location:
Chromosome 15 (position 13010321)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTCATTATTCAGTTTGAKTGTAAACATTGTCATTTTTTTTTTTTTTTC[A/T]GTAAGGTATGCAGTACWGGAACTGTCATCTCATTATCATGCTCTGGTAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2vtb4afg