pth2r

Ensembl ID:
ENSDARG00000006678
ZFIN ID:
ZDB-GENE-991123-10
Description:
parathyroid hormone 2 receptor [Source:RefSeq peptide;Acc:NP_571452]
Human Orthologue:
PTH2R
Human Description:
parathyroid hormone 2 receptor [Source:HGNC Symbol;Acc:9609]
Mouse Orthologue:
Pth2r
Mouse Description:
parathyroid hormone 2 receptor Gene [Source:MGI Symbol;Acc:MGI:2180917]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11169 Nonsense Available for shipment Available now
sa27411 Nonsense Mutation detected in F1 DNA During 2017
sa10665 Nonsense Available for shipment Available now
sa786 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11169
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014047 Nonsense 176 575 6 14
ENSDART00000122602 Nonsense 176 339 6 8
Genomic Location (Zv9):
Chromosome 9 (position 30258388)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29414334
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTCTTTGTCCTCACAGCAGGTCTTTTTTGAACGGCTGCACATCATGTA[C/A]ACAGTCGGCTATGCAGTTTCTTTCAGCTCTCTTCTAGTGGCCATCTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27411
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014047 Nonsense 196 575 6 14
ENSDART00000122602 Nonsense 196 339 6 8
Genomic Location (Zv9):
Chromosome 9 (position 30258328)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29414274
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGCAGTTTCTTTCAGCTCTCTTCTAGTGGCCATCTTTATTATCGGATA[T/A]TTCAGGTGAGGAACGGACTGTCTGTTTGATGTACCTTATCTTATAAACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10665
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014047 Nonsense 199 575 7 14
ENSDART00000122602 Nonsense 199 339 7 8
Genomic Location (Zv9):
Chromosome 9 (position 30254649)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29410595
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCATACKCTGACYTAATCAGTGTACTGTGTATTTCTGTGTGTCWTCAGA[C/T]GACTCCACTGCACCAGGAACTACATTCACATGCACCTGTTTGTTTCCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa786
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014047 Essential Splice Site 312 575 8 14
ENSDART00000122602   312 339 8 8
Genomic Location (Zv9):
Chromosome 9 (position 30228438)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29384384
KASP Assay ID:
554-0691.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTTGTCGGACTCCAAATACCTGTGGGGTTTCACTTTGATCGGGTGGGG[T/C]GAGTATACCAGAGTGAATGCGCTGGAAAAGGCAATTTGTCAATATAACCG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link