ripk1l

Ensembl ID:
ENSDARG00000006677
ZFIN ID:
ZDB-GENE-070705-132
Description:
receptor-interacting serine/threonine-protein kinase 1 [Source:RefSeq peptide;Acc:NP_001036815]
Human Orthologue:
RIPK1
Human Description:
receptor (TNFRSF)-interacting serine-threonine kinase 1 [Source:HGNC Symbol;Acc:10019]
Mouse Orthologue:
Ripk1
Mouse Description:
receptor (TNFRSF)-interacting serine-threonine kinase 1 Gene [Source:MGI Symbol;Acc:MGI:108212]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5116 Nonsense F2 line generated During 2017
sa39740 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa5116
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024967 Nonsense 23 661 1 10
ENSDART00000109397 Nonsense 23 675 2 11
Genomic Location (Zv9):
Chromosome 2 (position 1089597)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1035418
KASP Assay ID:
554-3563.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGAGTCTCATGAAATCAGCAGATCTGATCAAGAAAGAGCCTCTGGATTA[T/A]GGAGGATTTGGAGAAGTTTACTTGTGTTACCATAAAACTCTTGGACATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39740
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024967 Nonsense 31 661 1 10
ENSDART00000109397 Nonsense 31 675 2 11
Genomic Location (Zv9):
Chromosome 2 (position 1089620)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1035441
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGATCAAGAAAGAGCCTCTGGATTATGGAGGATTTGGAGAAGTTTACT[T/A]GTGTTACCATAAAACTCTTGGACATGTGGTGCTAAAGACCGTCTACACCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link