drg2

Ensembl ID:
ENSDARG00000006642
ZFIN ID:
ZDB-GENE-040808-29
Description:
developmentally-regulated GTP-binding protein 2 [Source:RefSeq peptide;Acc:NP_997803]
Human Orthologue:
DRG2
Human Description:
developmentally regulated GTP binding protein 2 [Source:HGNC Symbol;Acc:3030]
Mouse Orthologue:
Drg2
Mouse Description:
developmentally regulated GTP binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:1342307]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17617 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17617
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025285 Essential Splice Site 318 364 11 13
ENSDART00000129664 Essential Splice Site 318 364 10 12

The following transcripts of ENSDARG00000006642 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 40150868)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40014228
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCGGTGACCCTATAATCATGAGACGAGCAGCAKCAGTTAAACAYGTGG[T/C]ACGTCTATACATATCTACTTTCTTTATATAACTCTAGACTTTCAGTGGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link