eomesa

Ensembl ID:
ENSDARG00000006640
ZFIN IDs:
ZDB-GENE-001228-1, ZDB-GENE-001228-1
Description:
eomesodermin homolog [Source:RefSeq peptide;Acc:NP_571754]
Human Orthologue:
EOMES
Human Description:
eomesodermin [Source:HGNC Symbol;Acc:3372]
Mouse Orthologue:
Eomes
Mouse Description:
eomesodermin homolog (Xenopus laevis) Gene [Source:MGI Symbol;Acc:MGI:1201683]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32226 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32226
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007206 Nonsense 229 661 2 7
ENSDART00000122257 Nonsense 229 661 2 7
Genomic Location (Zv9):
Chromosome 19 (position 845161)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 866446
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTACCTGTGCAACAGACCGCTGTGGCTCAAATTTCACCGCCATCAAACT[G/T]AGATGATCATAACTAAACAGGGCAGGTAAGAAATGAAGCATTACAAATAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link