sc:d0319

Ensembl ID:
ENSDARG00000006636
ZFIN ID:
ZDB-GENE-080327-7
Description:
cDNA, clone cssl:d0319 [Source:UniProtKB/TrEMBL;Acc:A8BAV3]
Human Orthologue:
SLITRK2
Human Description:
SLIT and NTRK-like family, member 2 [Source:HGNC Symbol;Acc:13449]
Mouse Orthologue:
Slitrk2
Mouse Description:
SLIT and NTRK-like family, member 2 Gene [Source:MGI Symbol;Acc:MGI:2679449]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19079 Nonsense Mutation detected in F1 DNA During 2017
sa11011 Nonsense Available for shipment Available now
sa15552 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19079
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005738 Nonsense 64 854 1 1
ENSDART00000005738 Nonsense 64 854 1 1
Genomic Location (Zv9):
Chromosome 14 (position 20275155)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 18957444
KASP Assay ID:
2260-7452.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAAAACAAGGCTTTTACCACGGTCAGCCTGTTCCAGCCTCCGCAAAAC[A/T]AAATCAGTCAGCTCTTTCTGAATGGAAACTTTCTCACCAAGATAAGCCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11011
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005738 Nonsense 64 854 1 1
ENSDART00000005738 Nonsense 64 854 1 1
Genomic Location (Zv9):
Chromosome 14 (position 20275155)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 18957444
KASP Assay ID:
2260-7452.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGAAAACAAGGCTTTTACCACGGTCAGCCTGTTCCAGCCTCCGCAAAAC[A/T]AAATCAGTCAGCTCTTTCTGAATGGAAACTTTCTCACCAAGATAAGCCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15552
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005738 Nonsense 334 854 1 1
Genomic Location (Zv9):
Chromosome 14 (position 20275965)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 18958254
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTCACGTCTAGCAGAGATAAACACGTATTCGGGCCTATCATGGTGTAT[C/T]AGACGCGCTCGCCAGTCCCAATGACCTGTCCGGGCATTTGCGTGTGCACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link