ppp2r2a

Ensembl ID:
ENSDARG00000006624
ZFIN ID:
ZDB-GENE-030131-5474
Description:
serine/threonine-protein phosphatase 2A 55 kDa regulatory subunit B alpha isoform [Source:RefSeq pe
Human Orthologue:
PPP2R2A
Human Description:
protein phosphatase 2, regulatory subunit B, alpha [Source:HGNC Symbol;Acc:9304]
Mouse Orthologue:
Ppp2r2a
Mouse Description:
protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), alpha isoform Gene [Source:MGI Sy

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10037 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10037
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024127 Nonsense 52 448 3 10
ENSDART00000138334 Nonsense 52 448 4 11

The following transcripts of ENSDARG00000006624 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 18918022)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 18930368
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGTTCAACCACTCAGGGGAGCTGCTAGCCACAGGAGATAAAGGCGGA[C/T]GAGTAGTCATCTTYCARCAAGAGACCGAGGTACAGGATGAACYAGAGCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link