pspc1

Ensembl ID:
ENSDARG00000006621
ZFIN ID:
ZDB-GENE-030131-9530
Description:
Paraspeckle component 1 [Source:UniProtKB/Swiss-Prot;Acc:Q1JPY8]
Human Orthologue:
PSPC1
Human Description:
paraspeckle component 1 [Source:HGNC Symbol;Acc:20320]
Mouse Orthologue:
Pspc1
Mouse Description:
paraspeckle protein 1 Gene [Source:MGI Symbol;Acc:MGI:1913895]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19509 Nonsense Available for shipment Available now
sa39624 Essential Splice Site Mutation detected in F1 DNA During 2017
sa19510 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19509
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102335 Nonsense 210 512 2 9
Genomic Location (Zv9):
Chromosome 1 (position 26794865)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 27132553
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGTGGAGTTTGCTAATAAACCTGCTGCCCGGAAGGCCTTGGACCATTG[T/A]GCAGATGGGGCCCTTTTACTTACAACGTAATAACTTTTCTTTTTTAAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39624
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102335 Essential Splice Site 219 512 2 9
Genomic Location (Zv9):
Chromosome 1 (position 26794893)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 27132581
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCGGAAGGCCTTGGACCATTGTGCAGATGGGGCCCTTTTACTTACAACG[T/C]AATAACTTTTCTTTTTTAAAGGTTCATTCATTTATTTATGTTTGTTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19510
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102335 Essential Splice Site 317 512 4 9
Genomic Location (Zv9):
Chromosome 1 (position 26795390)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 27133078
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAATGGAGGCTGCCAAACAAGAACATCAACTAATGATGATGCGACAAGG[T/C]ATAGTGCAGATTTAGAACATCAACCAGTTTATTTTGTTTATTGCAATATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link