hnf1ba

Ensembl ID:
ENSDARG00000006615
ZFIN ID:
ZDB-GENE-020104-1
Description:
Hepatocyte nuclear factor 1-beta-A [Source:UniProtKB/Swiss-Prot;Acc:A1L1N5]
Human Orthologue:
HNF1B
Human Description:
HNF1 homeobox B [Source:HGNC Symbol;Acc:11630]
Mouse Orthologue:
Hnf1b
Mouse Description:
HNF1 homeobox B Gene [Source:MGI Symbol;Acc:MGI:98505]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10100 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10100
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006883 Essential Splice Site 358 559 4 9
ENSDART00000144138 Essential Splice Site 354 555 4 9
Genomic Location:
Chromosome 15 (position 15026255)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCCGCATCACCCACAAACTAGCAGCTCCCCACCAAGCAAGATGCAAGG[T/C]ACTGATACATTCACTKTGAGCTTACATGTGTTNTTTGAYTCTTCCTGGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1p3yy3zd