map2k2a

Ensembl ID:
ENSDARG00000006609
ZFIN ID:
ZDB-GENE-041027-1
Description:
mitogen-activated protein kinase kinase 2a [Source:RefSeq peptide;Acc:NP_001032468]
Human Orthologue:
MAP2K2
Human Description:
mitogen-activated protein kinase kinase 2 [Source:HGNC Symbol;Acc:6842]
Mouse Orthologue:
Map2k2
Mouse Description:
mitogen-activated protein kinase kinase 2 Gene [Source:MGI Symbol;Acc:MGI:1346867]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1721 Nonsense Available for shipment Available now
sa3186 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa1721
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010048 Nonsense 91 397 2 11
ENSDART00000129402 Nonsense 91 285 2 8
Genomic Location:
Chromosome 22 (position 20722758)
KASP Assay ID:
554-1667.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTGGCGCTGGTAATGGTGGAGTSGTTCATAAAGTCCGTCACAAACCCT[C/A]GAGACTGGTTATGGCCAGGAAGGTAAGCGATAAAGGATCTTATGCACCTG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa3186
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010048 Nonsense 178 397 5 11
ENSDART00000129402 Nonsense 178 285 5 8
Genomic Location:
Chromosome 22 (position 20716796)
KASP Assay ID:
554-3174.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCATTGATGATATCYATAACGCTCTCGCTCCACAGGTACTCAGAGGTT[T/A]GGCGTATCTTCGGGAGAAGCACCAAATAATGCACAGAGGTACGCACAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dfozkdh3