map2k2a

Ensembl ID:
ENSDARG00000006609
ZFIN ID:
ZDB-GENE-041027-1
Description:
mitogen-activated protein kinase kinase 2a [Source:RefSeq peptide;Acc:NP_001032468]
Human Orthologue:
MAP2K2
Human Description:
mitogen-activated protein kinase kinase 2 [Source:HGNC Symbol;Acc:6842]
Mouse Orthologue:
Map2k2
Mouse Description:
mitogen-activated protein kinase kinase 2 Gene [Source:MGI Symbol;Acc:MGI:1346867]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37498 Essential Splice Site Mutation detected in F1 DNA During 2016
sa1721 Nonsense Available for shipment Available now
sa3186 Nonsense F2 line generated During 2016

Mutation Details

Allele Name:
sa37498
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010048 Essential Splice Site 28 397 None 11
ENSDART00000129402 Essential Splice Site 28 285 None 8
Genomic Location (Zv9):
Chromosome 22 (position 20723020)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20377696
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACCCCCACTGGAGAGGGACAGTCAACCAACATTGATGCAGCAGCAGAG[T/A]AAGTATTTATTTAGCTATATCAGTGCCTTTATGTACCTGCACACGTCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1721
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010048 Nonsense 91 397 2 11
ENSDART00000129402 Nonsense 91 285 2 8
Genomic Location (Zv9):
Chromosome 22 (position 20722758)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20377434
KASP Assay ID:
554-1667.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTGGCGCTGGTAATGGTGGAGTSGTTCATAAAGTCCGTCACAAACCCT[C/A]GAGACTGGTTATGGCCAGGAAGGTAAGCGATAAAGGATCTTATGCACCTG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa3186
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010048 Nonsense 178 397 5 11
ENSDART00000129402 Nonsense 178 285 5 8
Genomic Location (Zv9):
Chromosome 22 (position 20716796)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20371472
KASP Assay ID:
554-3174.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCATTGATGATATCYATAACGCTCTCGCTCCACAGGTACTCAGAGGTT[T/A]GGCGTATCTTCGGGAGAAGCACCAAATAATGCACAGAGGTACGCACAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link