pvrl3l

Ensembl ID:
ENSDARG00000006604
ZFIN ID:
ZDB-GENE-050327-14
Description:
Poliovirus receptor-related protein 3-like [Source:UniProtKB/Swiss-Prot;Acc:Q58EG3]
Human Orthologue:
PVRL3
Human Description:
poliovirus receptor-related 3 [Source:HGNC Symbol;Acc:17664]
Mouse Orthologue:
Pvrl3
Mouse Description:
poliovirus receptor-related 3 Gene [Source:MGI Symbol;Acc:MGI:1930171]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20 Essential Splice Site Available for shipment Available now
sa21 Nonsense Confirmed mutation in F2 line During 2017
sa25156 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa20
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031205 Essential Splice Site 148 574 2 6
ENSDART00000141487   None 200 None 4
ENSDART00000147593 Essential Splice Site 148 574 3 7
Genomic Location (Zv9):
Chromosome 21 (position 20359564)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21435734
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCTTTCCGCTGGGTAACACACAGGCCTCCACCACTGTCAGCGTACTAG[G/A]TAACAAGAGACTGTGTGTGTGTGTGTGGATGCTGGATTGATAAAGGCCAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa21
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031205 Nonsense 192 574 3 6
ENSDART00000141487 Nonsense 44 200 1 4
ENSDART00000147593 Nonsense 192 574 4 7
Genomic Location (Zv9):
Chromosome 21 (position 20352175)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21428345
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGAGAGGGCTCGACCCCCTGCTGACGTGTCCTGGGAGACCAATCTGTA[T/A]GGGATGTCTGAGGCCCACATGCAGGAGGACGCCAACGGCACCACTACAAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa25156
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031205 Nonsense 422 574 6 6
ENSDART00000141487   None 200 None 4
ENSDART00000147593 Nonsense 422 574 7 7
Genomic Location (Zv9):
Chromosome 21 (position 20338501)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21414671
KASP Assay ID:
554-7290.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGGGGTTTATTACCAGCGTCAACGTCGGACTTTCCGCGGAGACTACTA[T/A]ACAAAGCAGTATCATGGCCCATCAGACATGCAGAAGGCTCCTCAGCCCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link