chrna2a

Ensembl ID:
ENSDARG00000006602
ZFIN ID:
ZDB-GENE-040108-2
Description:
cholinergic receptor, nicotinic, alpha polypeptide 2a [Source:RefSeq peptide;Acc:NP_001035417]
Human Orthologue:
CHRNA2
Human Description:
cholinergic receptor, nicotinic, alpha 2 (neuronal) [Source:HGNC Symbol;Acc:1956]
Mouse Orthologue:
Chrna2
Mouse Description:
cholinergic receptor, nicotinic, alpha polypeptide 2 (neuronal) Gene [Source:MGI Symbol;Acc:MGI:8788

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36297 Essential Splice Site Mutation detected in F1 DNA During 2017
sa28784 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36297
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033947 Essential Splice Site 91 520 3 6
Genomic Location (Zv9):
Chromosome 17 (position 5854714)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 5933650
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAGGATGAGAAGAATCAAATGATGACGACAAACGTTTGGCTGAAACAG[G/A]TGATGATCTTTATGTTTATTTCTAATGACCAATAAATTGGGCGACACGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28784
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033947 Nonsense 459 520 5 6
Genomic Location (Zv9):
Chromosome 17 (position 5861572)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 5940508
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGTAACCTGGTGTCAGAGCCTGGTCTGCTGTTTTCACCGTGTGTCCTG[C/T]GAGCTCTGGAAGGGGTGCGGTACATCGCTGATCATCTGAGGGCTGAGGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link