lsm14aa

Ensembl ID:
ENSDARG00000006600
ZFIN ID:
ZDB-GENE-040426-1567
Description:
protein LSM14 homolog A [Source:RefSeq peptide;Acc:NP_956719]
Human Orthologue:
LSM14A
Human Description:
LSM14A, SCD6 homolog A (S. cerevisiae) [Source:HGNC Symbol;Acc:24489]
Mouse Orthologue:
Lsm14a
Mouse Description:
LSM14 homolog A (SCD6, S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1914320]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7533 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7533
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023453 Missense 228 443 5 10
ENSDART00000041893 Missense 206 243 6 12
ENSDART00000125821 Missense 228 443 5 11
ENSDART00000135441 Missense 198 263 4 5
ENSDART00000147093 Missense 121 268 3 6
Genomic Location:
Chromosome 25 (position 36983894)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGTCCWGTTTCCACTCGCGTGGCCTCCACCAACACACAGAAACATGTG[G/T]ATCTGACGGAGCAAACCAGAGGTGAGGAAAACTYCARATGCTTCTAGACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qsca41eu