DMWD

Ensembl ID:
ENSDARG00000006585
Description:
dystrophia myotonica, WD repeat containing [Source:HGNC Symbol;Acc:2936]
Human Orthologue:
DMWD
Human Description:
dystrophia myotonica, WD repeat containing [Source:HGNC Symbol;Acc:2936]
Mouse Orthologue:
Dmwd
Mouse Description:
dystrophia myotonica-containing WD repeat motif Gene [Source:MGI Symbol;Acc:MGI:94907]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6121 Nonsense Mutation detected in F1 DNA During 2017
sa36006 Nonsense Mutation detected in F1 DNA During 2017
sa15635 Nonsense Available for shipment Available now
sa9222 Nonsense Mutation detected in F1 DNA During 2017
sa42635 Nonsense Mutation detected in F1 DNA During 2017
sa15488 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6121
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027060 Nonsense 131 586 4 5
Genomic Location (Zv9):
Chromosome 15 (position 46747893)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 47302408
KASP Assay ID:
554-3820.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATTCATTTAAACACCTGTAATYAATGTGCATCTTTATGTTKCACAGCT[A/T]AAAGTGTAACTAGTCAAGTATAATGTGAAAATGACAAAACCTGAACCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36006
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027060 Nonsense 173 586 5 5
Genomic Location (Zv9):
Chromosome 15 (position 46750288)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 47300015
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGAGAATCTGTTCCTGGCCTCGCACGCCAGCGGGCACCTGTACCTGTA[T/G]AACGTGGAGCATCCGTGCGGCACCACGGCCCCACAGTACTGTCTGCTGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15635
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027060 Nonsense 286 586 5 5
Genomic Location (Zv9):
Chromosome 15 (position 46750626)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 47299677
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGGAAATATCTGGCAACCGGCGGAGAGGAKGATTTAGTGACTGTGTGGT[C/A]GTTTTCTGAGAGTCGYGTKGTCGCTCGAGGACACGGACACAAGTCTTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9222
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027060 Nonsense 341 586 5 5
Genomic Location (Zv9):
Chromosome 15 (position 46750790)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 47299513
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GYGGCAGCGATGAGGATCTCCAGCAGGGGGCGCTGCACTTCGGGCGTGTG[C/T]GAACCAGTAGTACGCTSTCACGACTATCCAGACACAGCTYAAAGGGAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42635
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027060 Nonsense 348 586 5 5
Genomic Location (Zv9):
Chromosome 15 (position 46750811)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 47299492
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGGGGGCGCTGCACTTCGGGCGTGTGCGAACCAGTAGTACGCTCTCA[C/T]GACTATCCAGACACAGCTCAAAGGGAGGAGCGGCGTCCGTTTCGTATAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15488
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027060 Nonsense 373 586 5 5
Genomic Location (Zv9):
Chromosome 15 (position 46750886)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 47299417
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGAGCGGCGTCCGTTTCGTATAGATTCGGGTCGGTCGGACAGGATACG[C/T]AGTTTTGTTTGTGGGATCTAACRGATGATGTTTTATATCCGCGAYTTCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link