phf8

Ensembl ID:
ENSDARG00000006584
ZFIN ID:
ZDB-GENE-060419-1
Description:
Histone lysine demethylase PHF8 [Source:UniProtKB/Swiss-Prot;Acc:P0CH95]
Human Orthologue:
PHF8
Human Description:
PHD finger protein 8 [Source:HGNC Symbol;Acc:20672]
Mouse Orthologues:
4921501E09Rik, Phf8
Mouse Descriptions:
PHD finger protein 8 Gene [Source:MGI Symbol;Acc:MGI:2444341]
RIKEN cDNA 4921501E09 gene Gene [Source:MGI Symbol;Acc:MGI:1921292]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7309 Essential Splice Site Mutation detected in F1 DNA During 2017
sa9816 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa7309
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026314 Essential Splice Site 33 1032 2 22
Genomic Location (Zv9):
Chromosome 23 (position 27847323)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27680145
KASP Assay ID:
554-4740.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCGATTCATGATTGAGTGTGATGTTTGTCAGGACTGGTTTCATGGCAGG[T/G]GAGGTTGCAAAATTTTTAAATGACTGTTAAAAGCTAAATCTTGTACTTNN
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9816
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026314 Essential Splice Site 839 1032 19 22
Genomic Location (Zv9):
Chromosome 23 (position 27836634)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27669456
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAAATGAAAAGGAAGCGAAACTGGGATGATACCCCTTGGAGTCCCAAAG[G/A]TAAATAACATGTATGAAATAMATTTTTGCAGACTTTNNTTTTTTTTCTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link