cldnd

Ensembl ID:
ENSDARG00000006580
ZFIN ID:
ZDB-GENE-010328-4
Description:
Claudin-like protein ZF-A89 [Source:UniProtKB/Swiss-Prot;Acc:Q9YH91]
Human Orthologue:
CLDN4
Human Description:
claudin 4 [Source:HGNC Symbol;Acc:2046]
Mouse Orthologue:
Cldn4
Mouse Description:
claudin 4 Gene [Source:MGI Symbol;Acc:MGI:1313314]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3121 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa3121
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021620 Nonsense 64 208 1 1
Genomic Location:
Chromosome 21 (position 25157703)
KASP Assay ID:
554-2953.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGGCCTCTGGATGAACTGTGTGCAGCAAAGCACAGGTCAGATGCAGTG[C/A]AAGGTTTATGACTCCATGCTGGCTCTACCTCAAGACCTCCAGGCCGCCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2xrshd2g