rras

Ensembl ID:
ENSDARG00000006553
ZFIN ID:
ZDB-GENE-041010-217
Description:
ras-related protein R-Ras [Source:RefSeq peptide;Acc:NP_001005931]
Human Orthologue:
RRAS
Human Description:
related RAS viral (r-ras) oncogene homolog [Source:HGNC Symbol;Acc:10447]
Mouse Orthologue:
Rras
Mouse Description:
Harvey rat sarcoma oncogene, subgroup R Gene [Source:MGI Symbol;Acc:MGI:98179]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7267 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7267
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025496 Essential Splice Site 92 196 None 7
ENSDART00000061426 Essential Splice Site 92 118 None 6
ENSDART00000141793 Essential Splice Site 85 189 None 6

The following transcripts of ENSDARG00000006553 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 32549089)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32280399
KASP Assay ID:
554-4887.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCTGGAGAGGGCTTCTTACTGGTGTTTGCTCTTAATGACAGTGGCAGG[T/G]AGGTGTTTTCCTGAGTGTGTGTGACAAAGGGGAATAGGTAGTTTTCTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link