ak4

Ensembl ID:
ENSDARG00000006546
ZFIN ID:
ZDB-GENE-040426-2505
Description:
adenylate kinase isoenzyme 4, mitochondrial [Source:RefSeq peptide;Acc:NP_998464]
Human Orthologue:
AK4
Human Description:
adenylate kinase 4 [Source:HGNC Symbol;Acc:363]
Mouse Orthologue:
Ak4
Mouse Description:
adenylate kinase 4 Gene [Source:MGI Symbol;Acc:MGI:87979]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2314 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa2314
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027550 Nonsense 169 226 5 6
ENSDART00000134370 Nonsense 169 226 6 7
ENSDART00000145715 Nonsense 169 226 6 7
Genomic Location:
Chromosome 6 (position 31047908)
KASP Assay ID:
554-3163.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GRGAGGCACTGATTCAGCAGGAGGATGACAGACCAGAAGCCCTGGTGGCC[A/T]GACTGAGACACTACAAAGATGTTGCCAAACCTGTCATAGACTTCTATAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nmtxvm03