rgp1

Ensembl ID:
ENSDARG00000006545
ZFIN ID:
ZDB-GENE-040718-352
Description:
retrograde Golgi transport protein RGP1 homolog [Source:RefSeq peptide;Acc:NP_001002608]
Human Orthologue:
RGP1
Human Description:
RGP1 retrograde golgi transport homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:21965]
Mouse Orthologue:
Rgp1
Mouse Description:
RGP1 retrograde golgi transport homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1915956]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9882 Nonsense Available for shipment Available now
sa38608 Essential Splice Site Mutation detected in F1 DNA During 2016
sa20929 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9882
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048921 Nonsense 271 386 8 9
ENSDART00000147342   None 38 None 2
Genomic Location (Zv9):
Chromosome 7 (position 25802203)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 24363955
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTYAGTAAGTCTGCAAAGTGAAGAGGAGGTGCAGGAGCAGTATCAGAGA[C/T]GACCCGGCCAGGCAGTCAGTGTCACTGGTCATGGCCGACATCTAGAGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38608
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048921 Essential Splice Site 312 386 8 9
ENSDART00000147342   None 38 None 2
Genomic Location (Zv9):
Chromosome 7 (position 25802076)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 24363828
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTCTTCCTGTGCCTCTTAACGTCACACCAGGGTTCACCACAGATATAG[G/A]TAACAAAAACTTCATCATCTACAAATGTACAGAATATGTGTTAATTACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20929
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048921 Nonsense 374 386 9 9
ENSDART00000147342   None 38 None 2
Genomic Location (Zv9):
Chromosome 7 (position 25798991)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 24360743
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGACCTGCCAATCAAAGTGCTTCCCACCAATCCCACGCTCGCTTCATA[T/A]GTTTCACAGTTCACAGGGACAAACAGCATCAATATTTGAGTTGTGCTAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link