brd3a

Ensembl ID:
ENSDARG00000006527
ZFIN ID:
ZDB-GENE-030131-6141
Description:
bromodomain containing 3a [Source:RefSeq peptide;Acc:NP_001116861]
Human Orthologue:
BRD3
Human Description:
bromodomain containing 3 [Source:HGNC Symbol;Acc:1104]
Mouse Orthologue:
Brd3
Mouse Description:
bromodomain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1914632]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37272 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37272
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026708 Essential Splice Site 222 683 None 13
ENSDART00000126672 Essential Splice Site 222 514 None 11
ENSDART00000130597 Essential Splice Site 222 498 None 10
ENSDART00000135239 Essential Splice Site 222 683 None 12

The following transcripts of ENSDARG00000006527 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 16890503)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 18235452
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGCCGCTGTGATACCCAGCATGCCTCCATCACAACCCACGGTTAAAG[T/A]AAGTCACATGACTTCTCTGGACGTCACATGACATATTTAGTGTCGTTGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link