fn1b

Ensembl ID:
ENSDARG00000006526
ZFIN ID:
ZDB-GENE-030131-6545
Description:
fibronectin 1b [Source:RefSeq peptide;Acc:NP_001013279]
Human Orthologue:
FN1
Human Description:
fibronectin 1 [Source:HGNC Symbol;Acc:3778]
Mouse Orthologue:
Fn1
Mouse Description:
fibronectin 1 Gene [Source:MGI Symbol;Acc:MGI:95566]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa553 Nonsense Available for shipment Available now
sa19408 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19407 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa553
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017312 None None 194 None 8
ENSDART00000023692 Nonsense 36 2408 1 45
ENSDART00000103755 Nonsense 36 2500 1 46

The following transcripts of ENSDARG00000006526 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 4432026)
KASP Assay ID:
554-0463.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCACTGCATGCCACAATCCGCAGGGAAAAKTAAAAGACAAGCCCAGCAG[C/T]AGCAAATCCACCTGGACACAGTTTACGAAGAGGCCAGGAGTTTAGCCATC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa19408
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017312 None None 194 None 8
ENSDART00000023692 Essential Splice Site 55 2408 None 45
ENSDART00000103755 Essential Splice Site 55 2500 None 46

The following transcripts of ENSDARG00000006526 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 4431967)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCTGGACACAGTTTACGAAGAGGCCAGGAGTTTAGCCATCCACGAAAG[T/A]AAGTTCATCGACTTTTTTATATGCAGAAAAAATACAAACATTTCATAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19407
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017312 None None 194 None 8
ENSDART00000023692 Essential Splice Site 1983 2408 None 45
ENSDART00000103755 Essential Splice Site 2075 2500 None 46

The following transcripts of ENSDARG00000006526 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 4400491)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCTTTTTCCACGCAATAATGTTGGCCAGAACTATGCCACTATAGCCGG[T/G]AAGACACACATTGCATCACATTACAACCAGATGTGTAATAGACAGCAGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gw3p7k72