otop2

Ensembl ID:
ENSDARG00000006522
ZFIN ID:
ZDB-GENE-050104-2
Description:
Otopetrin 2 [Source:UniProtKB/TrEMBL;Acc:Q5MKL7]
Human Orthologue:
OTOP2
Human Description:
otopetrin 2 [Source:HGNC Symbol;Acc:19657]
Mouse Orthologue:
Otop2
Mouse Description:
otopetrin 2 Gene [Source:MGI Symbol;Acc:MGI:2388365]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33331 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33331
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124728 Nonsense 470 572 6 7
Genomic Location (Zv9):
Chromosome 3 (position 57573695)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 56845809
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGACTGAGGTGGCCACCGTCTTCGCCAACGTCATGGCTGTGAAGGAG[C/T]GAGACCCAGAGAGACGGAGCAGCTCCATCGTGCCCGCACACACACTCCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link