her6

Ensembl ID:
ENSDARG00000006514
ZFIN ID:
ZDB-GENE-980526-144
Description:
transcription factor HES-1 [Source:RefSeq peptide;Acc:NP_571154]
Human Orthologues:
HES1, HES4
Human Descriptions:
hairy and enhancer of split 1, (Drosophila) [Source:HGNC Symbol;Acc:5192]
hairy and enhancer of split 4 (Drosophila) [Source:HGNC Symbol;Acc:24149]
Mouse Orthologue:
Hes1
Mouse Description:
hairy and enhancer of split 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:104853]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20748 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20748
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023613 Essential Splice Site 68 270 2 4
ENSDART00000114279 Essential Splice Site 131 331 3 7

The following transcripts of ENSDARG00000006514 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 36330824)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGCTTGGGTCAGCTGAAAACGTTAATCTTGGATGCTCTGAAAAAAGAT[G/A]TAAGTACCGAAAGTCCGACTGAGTCTTTCAGTTAGGCTATATCTGGCTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9ph3elba