rtn1a

Ensembl ID:
ENSDARG00000006497
ZFIN ID:
ZDB-GENE-030131-2426
Description:
reticulon-1 isoform 1 [Source:RefSeq peptide;Acc:NP_001025138]
Human Orthologue:
RTN1
Human Description:
reticulon 1 [Source:HGNC Symbol;Acc:10467]
Mouse Orthologue:
Rtn1
Mouse Description:
reticulon 1 Gene [Source:MGI Symbol;Acc:MGI:1933947]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2734 Nonsense Mutation detected in F1 DNA During 2014
sa7727 Nonsense Mutation detected in F1 DNA During 2014
sa13604 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa2734
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057441 None None 165 None 8
ENSDART00000057445 Nonsense 46 249 1 7
ENSDART00000076548 Nonsense 46 157 1 8
ENSDART00000076571 None None 203 None 7
ENSDART00000076574 Nonsense 46 818 1 9

The following transcripts of ENSDARG00000006497 do not overlap with this mutation:

Genomic Location:
Chromosome 13 (position 31693721)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGGCCCCATTTCGACGAGATGCGGGACGATCTGCGTGCGCCCAAGCAA[C/T]AATTCCATCCCTTTGAAGGAACCGGCGTTGCCATGGAAACTGCATCTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7727
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057441 None None 165 None 8
ENSDART00000057445 None None 249 None 7
ENSDART00000076548 None None 157 None 8
ENSDART00000076571 None None 203 None 7
ENSDART00000076574 Nonsense 596 818 3 9

The following transcripts of ENSDARG00000006497 do not overlap with this mutation:

Genomic Location:
Chromosome 13 (position 31675587)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAACCCAGGCCCGCAGTAATGGGAACGTCWACAGTGACTCCSGAGAAG[C/T]AGCCCAGTCAGGAGAYGGAGAGTAAAAGCAAAAGCAGTATTGTTAGTTCS
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13604
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057441 Essential Splice Site 17 165 2 8
ENSDART00000057445 Essential Splice Site 63 249 2 7
ENSDART00000076548 None None 157 None 8
ENSDART00000076571 Essential Splice Site 17 203 2 7
ENSDART00000076574 Essential Splice Site 632 818 4 9

The following transcripts of ENSDARG00000006497 do not overlap with this mutation:

Genomic Location:
Chromosome 13 (position 31653142)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTAATTATGTTCATGTTCTTCTCTCTCTTTCTSTCYGTCTTTCTCCWCA[G/A]TGGTAGATCKAGTACACTGGCGGGATCTKAAGCAGTCTGGACTGGTGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ag0adyc5