rtn1a

Ensembl ID:
ENSDARG00000006497
ZFIN ID:
ZDB-GENE-030131-2426
Description:
reticulon-1 isoform 1 [Source:RefSeq peptide;Acc:NP_001025138]
Human Orthologue:
RTN1
Human Description:
reticulon 1 [Source:HGNC Symbol;Acc:10467]
Mouse Orthologue:
Rtn1
Mouse Description:
reticulon 1 Gene [Source:MGI Symbol;Acc:MGI:1933947]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42233 Essential Splice Site Mutation detected in F1 DNA During 2016
sa13604 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa42233
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057441   None 165 None 8
ENSDART00000057445 Essential Splice Site 62 249 1 7
ENSDART00000076548 Essential Splice Site 62 157 1 8
ENSDART00000076571   None 203 None 7
ENSDART00000076574 Essential Splice Site 62 818 1 9

The following transcripts of ENSDARG00000006497 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 31693669)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31339617
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCCATCCCTTTGAAGGAACCGGCGTTGCCATGGAAACTGCATCTACAG[G/A]TAAATTTGGGCTTTTTATAAATGGCCATTGTGTGTTTTAGCGACGACACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13604
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057441 Essential Splice Site 17 165 2 8
ENSDART00000057445 Essential Splice Site 63 249 2 7
ENSDART00000076548   None 157 None 8
ENSDART00000076571 Essential Splice Site 17 203 2 7
ENSDART00000076574 Essential Splice Site 632 818 4 9

The following transcripts of ENSDARG00000006497 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 31653142)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31299090
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTAATTATGTTCATGTTCTTCTCTCTCTTTCTSTCYGTCTTTCTCCWCA[G/A]TGGTAGATCKAGTACACTGGCGGGATCTKAAGCAGTCTGGACTGGTGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link