ddi2

Ensembl ID:
ENSDARG00000006477
ZFIN ID:
ZDB-GENE-031030-15
Description:
Protein DDI1 homolog 2 [Source:UniProtKB/Swiss-Prot;Acc:Q6TH22]
Human Orthologues:
DDI1, DDI2
Human Descriptions:
DNA-damage inducible 1 homolog 1 (S. cerevisiae) [Source:HGNC Symbol;Acc:18961]
DNA-damage inducible 1 homolog 2 (S. cerevisiae) [Source:HGNC Symbol;Acc:24578]
Mouse Orthologues:
Ddi1, Ddi2
Mouse Descriptions:
DDI1, DNA-damage inducible 1, homolog 1 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1919079]
DNA-damage inducible protein 2 Gene [Source:MGI Symbol;Acc:MGI:1917244]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20777 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20777
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017859 Essential Splice Site 406 409 8 10
Genomic Location (Zv9):
Chromosome 6 (position 40490815)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40562415
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGATCGAGAACTGGCTGAGGCAATACAAAGATCTGTACAGGACAGCGG[T/G]AAGATGCATGATATGTAGATTAAGAAATGGCATGACGTAAGGGTTGAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link