grap2a

Ensembl ID:
ENSDARG00000006468
ZFIN ID:
ZDB-GENE-050417-275
Description:
GRB2-related adaptor protein 2 [Source:RefSeq peptide;Acc:NP_001017756]
Human Orthologues:
GRAP2, NCK2
Human Descriptions:
GRB2-related adaptor protein 2 [Source:HGNC Symbol;Acc:4563]
NCK adaptor protein 2 [Source:HGNC Symbol;Acc:7665]
Mouse Orthologue:
Grap2
Mouse Description:
GRB2-related adaptor protein 2 Gene [Source:MGI Symbol;Acc:MGI:1333842]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33184 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33184
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020381 Nonsense 39 284 4 9
ENSDART00000134258 Nonsense 39 237 2 7
Genomic Location (Zv9):
Chromosome 3 (position 29612312)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 29330351
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTTTTGACAGATTCTGGGGTCTCAGGACGATTGGTTCAAAGCAGAGT[T/A]ACATGGCCATGAGGGTTATGTGCCGAAAAACTATGTTGACAGGCAGATAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Addiction: NCK2 is significantly associated with opiates addiction in African-origin men. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link