pcdh8

Ensembl ID:
ENSDARG00000006467
ZFIN ID:
ZDB-GENE-980526-242
Description:
protocadherin 8 [Source:RefSeq peptide;Acc:NP_571284]
Human Orthologue:
PCDH8
Human Description:
protocadherin 8 [Source:HGNC Symbol;Acc:8660]
Mouse Orthologue:
Pcdh8
Mouse Description:
protocadherin 8 Gene [Source:MGI Symbol;Acc:MGI:1306800]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21612 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21612
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126314 Nonsense 394 950 1 5
Genomic Location (Zv9):
Chromosome 9 (position 55665452)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 54124825
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGGGCCGAATGGTTATGTTCGGACGAGTCTTGAAGGACATGAGCATTTT[A/T]AACTACAGCAAGCCTACAGCGACACGTTTATGATCATAACAACCACAACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link