pdgfrl

Ensembl ID:
ENSDARG00000006456
ZFIN ID:
ZDB-GENE-040426-901
Description:
platelet-derived growth factor receptor-like [Source:RefSeq peptide;Acc:NP_956608]
Human Orthologue:
PDGFRL
Human Description:
platelet-derived growth factor receptor-like [Source:HGNC Symbol;Acc:8805]
Mouse Orthologue:
Pdgfrl
Mouse Description:
platelet-derived growth factor receptor-like Gene [Source:MGI Symbol;Acc:MGI:1916047]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35708 Essential Splice Site Mutation detected in F1 DNA During 2017
sa6346 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35708
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007022 Essential Splice Site 263 371 4 6
ENSDART00000007022 Essential Splice Site 263 371 4 6
Genomic Location (Zv9):
Chromosome 14 (position 31230398)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 30020455
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAACCACCCCGCAAATATCAACTAAATACCAACTGCTGTATGTGGAGGG[T/C]AAGAGGAGAACATACATTTACTGTCAGGATACACATTTTTGGCATTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6346
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007022 Nonsense 303 371 5 6
Genomic Location (Zv9):
Chromosome 14 (position 31230206)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 30020263
KASP Assay ID:
554-5086.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTACCTGCACAGTGCTGGGTGAACCAGAGATGAATGTCAGCTTCAGCT[G/A]GAGGTATCCCGGCCAGGTAAGTWTTGCATTTWTACACATTAAGGGCTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link