LOC557854

Ensembl ID:
ENSDARG00000006447
Human Orthologue:
SLC19A3
Human Description:
solute carrier family 19, member 3 [Source:HGNC Symbol;Acc:16266]
Mouse Orthologue:
Slc19a3
Mouse Description:
solute carrier family 19 (sodium/hydrogen exchanger), member 3 Gene [Source:MGI Symbol;Acc:MGI:19313

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9460 Nonsense Available for shipment Available now
sa8826 Nonsense Available for shipment Available now
sa9738 Nonsense Available for shipment Available now
sa28507 Essential Splice Site Mutation detected in F1 DNA During 2016
sa11401 Nonsense Available for shipment Available now
sa981 Nonsense Available for shipment Available now
sa9099 Essential Splice Site Mutation detected in F1 DNA During 2016
sa6389 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa9460
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059204 Nonsense 30 501 1 6
ENSDART00000059204 Nonsense 30 501 1 6
Genomic Location (Zv9):
Chromosome 15 (position 34435977)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35281753
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCACTTCTCTCTTGTTYATCTATGGATTCTTCAGCACAGTCAAGCCTT[T/A]AGAGCCGTTTCTYTACCCATTCCTCACTGGACCAGACAAGAACCTGMCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8826
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059204 Nonsense 30 501 1 6
ENSDART00000059204 Nonsense 30 501 1 6
Genomic Location (Zv9):
Chromosome 15 (position 34435977)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35281753
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCACTTCTCTCTTGTTYATCTATGGATTCTTCAGCACAGTCAAGCCTT[T/A]AGAGCCGTTTCTYTACCCATTCCTCACTGGACCAGACAAGAACCTGMCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9738
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059204 Nonsense 218 501 2 6
Genomic Location (Zv9):
Chromosome 15 (position 34440557)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35286333
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGAGCGAAGAGGATGATRMTGAAGGACATTCTGGGAATGTCAAACCTT[T/A]GGAGCCTGAGGAAGGATTTGGGACAATGGTTGATCTTAGTAATGATGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28507
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059204 Essential Splice Site 265 501 2 6
Genomic Location (Zv9):
Chromosome 15 (position 34440701)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35286477
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATGGCTGTGATAGTAGTAGTGCAAAAAGTTCCAAGTCGAGTAGGAAAG[G/A]TGAGTTGAATCTGCAAAAAAAGAGTGCATTAATGGATCGCCTGAAAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11401
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059204 Nonsense 291 501 3 6
Genomic Location (Zv9):
Chromosome 15 (position 34443431)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35289207
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTRTGGAGGGATTTCCTGCAGTGTTTCTCCTCCCGAACRCTGCTTCTCT[G/A]GTCAGCCTGGTGGGCTTTGGCCACTTGTGGCTACAACCAGACGGTCAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa981
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059204 Nonsense 325 501 3 6
Genomic Location (Zv9):
Chromosome 15 (position 34443534)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35289310
KASP Assay ID:
554-0886.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCAGTCRCTCTGGGAGCATGTAGAGCCTTCTAGTAACTTCACAGTCTA[C/A]AATGGAGGAGCGGAGGCACTCTCAAACCTGTTCGGTGAGAAAAAAGAAAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa9099
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059204 Essential Splice Site 337 501 3 6
Genomic Location (Zv9):
Chromosome 15 (position 34443570)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35289346
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTTCACWGTCTAMAATGGAGGAGCGGAGGCACTCTCAAACCTGTTCGG[T/G]GAGAAAAAAGAAAAGACCTTAGACATGCAAAGATGTTGCCCGTTGCATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6389
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059204 Nonsense 393 501 4 6
Genomic Location (Zv9):
Chromosome 15 (position 34445720)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35291496
KASP Assay ID:
554-4510.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGAACATCTGGGTCTGTTACGGCGGCTACATCCTCTTTAAAAGCCTCTA[T/A]ATGCTGCTCATCACCATTGCCATGTAAGTGAAATGACTTACTATCTATGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link