esyt3

Ensembl ID:
ENSDARG00000006422
ZFIN ID:
ZDB-GENE-050809-35
Description:
extended synaptotagmin-3 [Source:RefSeq peptide;Acc:NP_001116705]
Human Orthologue:
ESYT3
Human Description:
extended synaptotagmin-like protein 3 [Source:HGNC Symbol;Acc:24295]
Mouse Orthologue:
Esyt3
Mouse Description:
extended synaptotagmin-like protein 3 Gene [Source:MGI Symbol;Acc:MGI:1098699]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18472 Nonsense Available for shipment Available now
sa17355 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18472
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027443 Nonsense 241 861 6 23

The following transcripts of ENSDARG00000006422 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 24832210)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATTGGCCAGGCACCCCTTGTAGGTGGAGTCAYTATGTTTTTCATTCGT[C/T]GACCTGTGAGTATGGACAATGCTTAAAATTGGTTTGTTTWAAGTATATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17355
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027443 Nonsense 689 861 18 23

The following transcripts of ENSDARG00000006422 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 24821824)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTGGGCTCAGAGGGGCTGCAATCGACCCCTTCCACCCCCGGTCCAATG[C/T]GACGCTATGATTCCCACAGCCTTTTGTCWGAGAACTCGATTGCTTCTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ixpo2ukv