esyt3

Ensembl ID:
ENSDARG00000006422
ZFIN ID:
ZDB-GENE-050809-35
Description:
extended synaptotagmin-3 [Source:RefSeq peptide;Acc:NP_001116705]
Human Orthologue:
ESYT3
Human Description:
extended synaptotagmin-like protein 3 [Source:HGNC Symbol;Acc:24295]
Mouse Orthologue:
Esyt3
Mouse Description:
extended synaptotagmin-like protein 3 Gene [Source:MGI Symbol;Acc:MGI:1098699]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31712 Nonsense Mutation detected in F1 DNA During 2016
sa18472 Nonsense Available for shipment Available now
sa34636 Nonsense Mutation detected in F1 DNA During 2016
sa41414 Nonsense Mutation detected in F1 DNA During 2016
sa17355 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31712
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027443 Nonsense 202 861 5 23

The following transcripts of ENSDARG00000006422 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 24833855)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23989641
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATCAACTGTAGTTACGAGGCTGATGTGGACATTGATGCTGATGTAAAC[C/T]GAGCCATTAAAGTAGGAATCAAAGGGCTTCAGGTTAGTGAAGGAAAGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18472
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027443 Nonsense 241 861 6 23

The following transcripts of ENSDARG00000006422 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 24832210)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23987996
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATTGGCCAGGCACCCCTTGTAGGTGGAGTCAYTATGTTTTTCATTCGT[C/T]GACCTGTGAGTATGGACAATGCTTAAAATTGGTTTGTTTWAAGTATATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34636
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027443 Nonsense 289 861 8 23

The following transcripts of ENSDARG00000006422 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 24828476)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23984262
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGCCTCTCTCATGGTTCTGCCCAATCGCATGTGCTTCCCTTTAATTGAT[C/T]AAGTCAAGGTTGAACAAATGAGGTTTCCTCTTCCTCGAGTAAGACTGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41414
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027443 Nonsense 664 861 18 23

The following transcripts of ENSDARG00000006422 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 24821897)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23977683
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCAAGTTCCATTTTCAGTTGTGCCCTTAAATGATCTTCAAGCAGAGTA[T/A]CCTCCCTACAGACGAAGCACTTTTGTGGGCTCAGAGGGGCTGCAATCGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17355
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027443 Nonsense 689 861 18 23

The following transcripts of ENSDARG00000006422 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 24821824)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23977610
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTGGGCTCAGAGGGGCTGCAATCGACCCCTTCCACCCCCGGTCCAATG[C/T]GACGCTATGATTCCCACAGCCTTTTGTCWGAGAACTCGATTGCTTCTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link