atrnl1

Ensembl ID:
ENSDARG00000006420
ZFIN ID:
ZDB-GENE-030131-8092
Human Orthologue:
ATRNL1
Human Description:
attractin-like 1 [Source:HGNC Symbol;Acc:29063]
Mouse Orthologue:
Atrnl1
Mouse Description:
attractin like 1 Gene [Source:MGI Symbol;Acc:MGI:2147749]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6257 Nonsense Mutation detected in F1 DNA During 2014
sa22125 Nonsense Mutation detected in F1 DNA During 2014
sa18278 Nonsense Available for shipment Available now
sa8730 Nonsense Mutation detected in F1 DNA During 2014
sa7363 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6257
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042514 Nonsense 202 1364 5 29
Genomic Location:
Chromosome 12 (position 31549636)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAACAGAATCAACTCATGTCCAAATAACTGCTCTGGCCACGGGAAGTG[T/A]TCCTCGGGGAACTCGAYAGCGAGTCGTGTGTATTGTGACTGTGAGAACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22125
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042514 Nonsense 207 1364 5 29
Genomic Location:
Chromosome 12 (position 31549622)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCATGTCCAAATAACTGCTCTGGCCACGGGAAGTGTTCCTCGGGGAACT[C/A]GATAGCGAGTCGTGTGTATTGTGACTGTGAGAACTTCTGGAAGGGTGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18278
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042514 Nonsense 468 1364 9 29
Genomic Location:
Chromosome 12 (position 31541713)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGTGTGTATGATAGAGGCAGCAAAAGTGTGTACGTCCAYGRGGGTTA[C/A]AGAWCTCTTCCAGCAAACAAATATGGCCTGGTGGATGAWCTTTACCGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8730
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042514 Nonsense 961 1364 18 29
Genomic Location:
Chromosome 12 (position 31522848)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGGAGACCCCAGTAACACCGGCCGAGGGCAGTGCATGGAGGGTTCGTA[T/G]CGCGGACCCATGAAGAGCCCCTCCAGACACAGTCAAGACATGGTGCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7363
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042514 Missense 1198 1364 24 29
Genomic Location:
Chromosome 12 (position 31494817)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGYAACCCAAACATCACMTTCTATGTGTATGTCAGCAACTTCTCATGG[C/G]CAATCAAAATACAGGTAAGGACTCTTTTCCTCTGGTTTGTCAGCTATTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/r1nkolkp