si:dkey-14d8.5

Ensembl ID:
ENSDARG00000006409
ZFIN ID:
ZDB-GENE-041210-123
Description:
mitogen-activated protein kinase 12 [Source:RefSeq peptide;Acc:NP_001038306]
Human Orthologue:
MAPK12
Human Description:
mitogen-activated protein kinase 12 [Source:HGNC Symbol;Acc:6874]
Mouse Orthologue:
Mapk12
Mouse Description:
mitogen-activated protein kinase 12 Gene [Source:MGI Symbol;Acc:MGI:1353438]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40217 Essential Splice Site Mutation detected in F1 DNA During 2017
sa14265 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40217
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027304 Essential Splice Site 229 364 9 12
Genomic Location (Zv9):
Chromosome 4 (position 5401940)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5520121
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGACAATCGGCTCTCTTTTCCCCCAATAAATCCTTAACTTAGACTTAC[A/T]GACCTAGACCAGCTGAGAGAGATCATGAAAATCACAGGAACTCCAGCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14265
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027304 Nonsense 250 364 9 12
Genomic Location (Zv9):
Chromosome 4 (position 5402004)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5520185
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGAGAGATCATGAAAATCACAGGAACTCCAGCTCCGGATTTYATCRCC[A/T]AGCTACAAAGCCAAGATGTGAGTGTGTCACACATAAAAAGAAAGATTART
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link