laptm4a

Ensembl ID:
ENSDARG00000006397
ZFIN ID:
ZDB-GENE-030131-1024
Description:
lysosomal-associated transmembrane protein 4A [Source:RefSeq peptide;Acc:NP_999850]
Human Orthologue:
LAPTM4A
Human Description:
lysosomal protein transmembrane 4 alpha [Source:HGNC Symbol;Acc:6924]
Mouse Orthologue:
Laptm4a
Mouse Description:
lysosomal-associated protein transmembrane 4A Gene [Source:MGI Symbol;Acc:MGI:108017]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43521 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43521
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004601 Nonsense 18 238 1 7
Genomic Location (Zv9):
Chromosome 20 (position 43818095)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 43889254
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTCTTCAAAGCACCGAGAACGACATGCGTTTTAAACCGTCTCGAGAC[C/T]GACTATACAGCGCGCGCTGCTGCGGCTGCTGTCATGTGCGGACTGGAACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Major depressive disorder: Genome-wide association analysis of gender differences in major depressive disorder in the Netherlands NESDA and NTR population-based samples. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link