rbm25

Ensembl ID:
ENSDARG00000006395
ZFIN ID:
ZDB-GENE-030131-5547
Description:
RNA binding motif protein 25 [Source:RefSeq peptide;Acc:NP_956084]
Human Orthologues:
AC002365.1, AC003980.1, AC006062.1, AC006999.1, AC007379.1, AC008162.1, AC008573.1, AC008794.1, AC009021.1, AC010133.1, AC011503.2, AC012596.1, AC016595.1, AC022409.1, AC022486.1, AC023481.1, AC067941.1, AC092485.1, AC097714.1, AC116351.3, AL121899.1, AL138690.1, AL159986.1, AL357512.1, AL591242.1, RBM25
Human Description:
RNA binding motif protein 25 [Source:HGNC Symbol;Acc:23244]
Mouse Orthologues:
Gm10563, Rbm25
Mouse Descriptions:
predicted gene 10563 Gene [Source:MGI Symbol;Acc:MGI:3642630]
RNA binding motif protein 25 Gene [Source:MGI Symbol;Acc:MGI:1914289]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3072 Nonsense F2 line generated During 2017
sa23821 Nonsense Available for shipment Available now
sa43545 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa3072
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027836 Nonsense 172 830 6 18
ENSDART00000113929 Nonsense 172 833 5 20
ENSDART00000114407 Nonsense 172 731 6 16

The following transcripts of ENSDARG00000006395 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 51508734)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 51360803
KASP Assay ID:
554-2928.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCTTCTGGTCAAAGTGGATGCCAAAACCAAAGCACAACTGGACGAGTG[G/A]AAAGCAAAGAAGAAGAGCACCAGTGCAAACGGAGTCAGTATTATACCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23821
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027836 Nonsense 359 830 9 18
ENSDART00000113929 Nonsense 315 833 9 20
ENSDART00000114407 Nonsense 359 731 9 16

The following transcripts of ENSDARG00000006395 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 51491705)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 51343774
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAGAGATTGGGAGAGAGACCGAAGCAGAGACCGAAGCGAGGGCCGCAGT[C/T]GATCCAGGTATGCAACACCTCACCTCTTCAGGTGGCCTATTATGACGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43545
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027836 Nonsense 633 830 14 18
ENSDART00000113929 Nonsense 636 833 16 20
ENSDART00000114407 Nonsense 633 731 14 16

The following transcripts of ENSDARG00000006395 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 51480567)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 51332636
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTCCCAGAGAAGAGTCACCCTGCGGCATCATCATCCCACATGAGAACT[C/A]GCCACAGGAGATGCTGCTTCCGGAAGAGAACAGGCCCAAGATCGGCCTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link