si:ch211-194d6.1

Ensembl ID:
ENSDARG00000006383
ZFIN ID:
ZDB-GENE-041210-220
Description:
Syntaxin-binding protein 5-like [Source:UniProtKB/Swiss-Prot;Acc:Q5SQE2]
Human Orthologue:
STXBP5L
Human Description:
syntaxin binding protein 5-like [Source:HGNC Symbol;Acc:30757]
Mouse Orthologue:
Stxbp5l
Mouse Description:
syntaxin binding protein 5-like Gene [Source:MGI Symbol;Acc:MGI:2443815]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31716 Nonsense Available for shipment Available now
sa34660 Essential Splice Site Mutation detected in F1 DNA During 2017
sa34659 Essential Splice Site Available for shipment Available now
sa2514 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa31716
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017292 Nonsense 193 1159 5 26
ENSDART00000138602   None 214 None 3
Genomic Location (Zv9):
Chromosome 9 (position 28554257)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 27709953
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTGGGAATACACACATAGTGAACATTGAATCCTTCATTTTGTCTGGATA[T/A]GTCATCATGTGGAACAAGGCCATTGAACTGTGAGTACAAGCTGTTTTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34660
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017292 Essential Splice Site 482 1159 14 26
ENSDART00000138602   None 214 None 3
Genomic Location (Zv9):
Chromosome 9 (position 28507016)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 27662712
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCACAGACATGCAGACGGATCGATAAAGTTTTGGGATGCCACAGCGAG[T/C]AAGTGTCTTAGCTTTGAAGAGCTTGTGCTTCTCTTTCAGCCTCATGCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34659
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017292 Essential Splice Site 1072 1159 24 26
ENSDART00000138602   None 214 None 3
Genomic Location (Zv9):
Chromosome 9 (position 28454960)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 27610656
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAGGGCTTTTTTGGTGGCAATGCCCAAACCTTCGACAGAGAGGAGTTAT[G/T]TGAGTGTGCATATATTTATCAAGCCCCCCTCACCCCCTCTTTCTCTCGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2514
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017292 Nonsense 1156 1159 26 26
ENSDART00000138602   None 214 None 3
Genomic Location (Zv9):
Chromosome 9 (position 28449752)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 27605448
KASP Assay ID:
554-3208.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTTTCCTTTTTTTCCACAGCTAATGCTTAAATGCAAAGRCAAGAAGTG[G/A]TATCAGTTTTAGAGGGTCCTCTTGGAGGCGTGTTTCACTGTCRTGCCACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Aging (facial): A genome-wide association study in Caucasian women points out a putative role of the STXBP5L gene in facial photoaging. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link