ugt5c2

Ensembl ID:
ENSDARG00000006372
ZFIN ID:
ZDB-GENE-060825-206
Description:
UDP glucuronosyltransferase 5 family, polypeptide C2 [Source:RefSeq peptide;Acc:NP_001038851]
Human Orthologue:
UGT8
Human Description:
UDP glycosyltransferase 8 [Source:HGNC Symbol;Acc:12555]
Mouse Orthologue:
Ugt8a
Mouse Description:
UDP galactosyltransferase 8A Gene [Source:MGI Symbol;Acc:MGI:109522]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36708 Nonsense Mutation detected in F1 DNA During 2016
sa14335 Nonsense Available for shipment Available now
sa36709 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa36708
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087645 Nonsense 137 552 2 2
ENSDART00000087647 Nonsense 116 531 1 1
Genomic Location:
Chromosome 18 (position 38765156)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAATACGAAAAAGAAAAAGGCTCCTGGCTGAGTATTGTAAGGCTGTATT[T/A]AAATGTGTTTGATGCTGTCAAAAAAACTCATGAAATGGTGTGTCAGCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14335
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087645 Nonsense 425 552 2 2
ENSDART00000087647 Nonsense 404 531 1 1
Genomic Location:
Chromosome 18 (position 38766021)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTACCATGGTGTTCCAGTGATTGGAATYCCATTCTTTTTTGACCAGTA[T/G]GACAATCTCATTCGAYTACAAGCAAGAGGTGGAGCCAAGTTGCTTTCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36709
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087645 Nonsense 438 552 2 2
ENSDART00000087647 Nonsense 417 531 1 1
Genomic Location:
Chromosome 18 (position 38766058)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTGACCAGTATGACAATCTCATTCGATTACAAGCAAGAGGTGGAGCC[A/T]AGTTGCTTTCCATTGCAGATCTAGGTGAAAACACACTGCATGCAGCAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link