ugt5c2

Ensembl ID:
ENSDARG00000006372
ZFIN ID:
ZDB-GENE-060825-206
Description:
UDP glucuronosyltransferase 5 family, polypeptide C2 [Source:RefSeq peptide;Acc:NP_001038851]
Human Orthologue:
UGT8
Human Description:
UDP glycosyltransferase 8 [Source:HGNC Symbol;Acc:12555]
Mouse Orthologue:
Ugt8a
Mouse Description:
UDP galactosyltransferase 8A Gene [Source:MGI Symbol;Acc:MGI:109522]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14335 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14335
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087645 Nonsense 425 552 2 2
ENSDART00000087647 Nonsense 404 531 1 1
Genomic Location:
Chromosome 18 (position 38766021)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTACCATGGTGTTCCAGTGATTGGAATYCCATTCTTTTTTGACCAGTA[T/G]GACAATCTCATTCGAYTACAAGCAAGAGGTGGAGCCAAGTTGCTTTCCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/109zcr59