crlf1b

Ensembl ID:
ENSDARG00000006368
ZFIN ID:
ZDB-GENE-080108-1
Description:
cytokine receptor-like factor 1b [Source:RefSeq peptide;Acc:NP_001107074]
Human Orthologue:
CRLF1
Human Description:
cytokine receptor-like factor 1 [Source:HGNC Symbol;Acc:2364]
Mouse Orthologue:
Crlf1
Mouse Description:
cytokine receptor-like factor 1 Gene [Source:MGI Symbol;Acc:MGI:1340030]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6708 Essential Splice Site Mutation detected in F1 DNA During 2014
sa6709 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6708
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007321 Essential Splice Site None 416 1 9
ENSDART00000110027 Essential Splice Site None 412 1 9
Genomic Location:
Chromosome 22 (position 21474706)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTTGAGGCGTACTCTATATTGATTCCTCTCCAAAATTGAGAGTGAAGG[T/G]AAATCTGAGCGTCCTCTTCGCATAATGATGCTTTTCAGAAGCAGCAATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6709
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007321 Nonsense 93 416 3 9
ENSDART00000110027 Nonsense 89 412 3 9
Genomic Location:
Chromosome 22 (position 21476865)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATAACAGCTAGGTCCTTGTACTGGACACTGAATGGGAGACGCTTGGCT[A/T]GAAACACGTACAGAGTCCTGAGCCAGACCGAATCGAGTGTCACACTTCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/u8n4ws1u