crlf1b

Ensembl ID:
ENSDARG00000006368
ZFIN ID:
ZDB-GENE-080108-1
Description:
cytokine receptor-like factor 1b [Source:RefSeq peptide;Acc:NP_001107074]
Human Orthologue:
CRLF1
Human Description:
cytokine receptor-like factor 1 [Source:HGNC Symbol;Acc:2364]
Mouse Orthologue:
Crlf1
Mouse Description:
cytokine receptor-like factor 1 Gene [Source:MGI Symbol;Acc:MGI:1340030]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6708 Essential Splice Site Mutation detected in F1 DNA During 2015
sa6709 Nonsense Mutation detected in F1 DNA During 2015
sa30729 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa6708
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007321 Essential Splice Site None 416 1 9
ENSDART00000110027 Essential Splice Site None 412 1 9
Genomic Location:
Chromosome 22 (position 21474706)
KASP Assay ID:
554-4493.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTTGAGGCGTACTCTATATTGATTCCTCTCCAAAATTGAGAGTGAAGG[T/G]AAATCTGAGCGTCCTCTTCGCATAATGATGCTTTTCAGAAGCAGCAATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6709
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007321 Nonsense 93 416 3 9
ENSDART00000110027 Nonsense 89 412 3 9
Genomic Location:
Chromosome 22 (position 21476865)
KASP Assay ID:
554-4827.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATAACAGCTAGGTCCTTGTACTGGACACTGAATGGGAGACGCTTGGCT[A/T]GAAACACGTACAGAGTCCTGAGCCAGACCGAATCGAGTGTCACACTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30729
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007321 Nonsense 126 416 3 9
ENSDART00000110027 Nonsense 122 412 3 9
Genomic Location:
Chromosome 22 (position 21476964)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAACTCAATGGCTCCTTGCAGCAGTCAGGAGATAATCTGGTTTGCCAT[C/T]GAAGTAATGGAGAAGTGCTGGCCGGGTCCTGTCTTTATGTCGGCTGTGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/u8n4ws1u