itga5

Ensembl ID:
ENSDARG00000006353
ZFIN ID:
ZDB-GENE-031116-52
Description:
integrin alpha-5 [Source:RefSeq peptide;Acc:NP_001004288]
Human Orthologue:
ITGA5
Human Description:
integrin, alpha 5 (fibronectin receptor, alpha polypeptide) [Source:HGNC Symbol;Acc:6141]
Mouse Orthologue:
Itga5
Mouse Description:
integrin alpha 5 (fibronectin receptor alpha) Gene [Source:MGI Symbol;Acc:MGI:96604]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13598 Nonsense Available for shipment Available now
sa5062 Nonsense Mutation detected in F1 DNA During 2014
sa13837 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13598
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018301 Nonsense 308 1053 10 30
ENSDART00000103275 Nonsense 290 1035 10 30

The following transcripts of ENSDARG00000006353 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 33713431)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCCATTCTCAATAGCTCTCTGGATGTGCTGAAGATGTTCACTGGTGAA[C/T]AGGCAAGTTTGATGGCTTTCTGTWTTATTGATGCTTTTCCAAGATTAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5062
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018301 Nonsense 624 1053 18 30
ENSDART00000103275 Nonsense 606 1035 18 30

The following transcripts of ENSDARG00000006353 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 33698155)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCCTCAAGCAGCAGCAGACAGGCACGGWCTGCRGCCCATCCTCAACTA[C/G]CAGACGGCRGAGCTCATTGAACAGAAAGTACGTACATCTGCTGCTGCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13837
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018301 Nonsense 931 1053 27 30
ENSDART00000103275 Nonsense 913 1035 27 30

The following transcripts of ENSDARG00000006353 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 33667088)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTTGCTCCAGTGTGGACTGTTGGACTCTBRTGTGTAATGTWGGCCTGT[T/A]GGAGCGAGGGACKAGTGCCATACTTCMTGTTCGCTCACGAATTTGGGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gs00rgrb