MED17

Ensembl ID:
ENSDARG00000006345
Description:
mediator complex subunit 17 [Source:HGNC Symbol;Acc:2375]
Human Orthologue:
MED17
Human Description:
mediator complex subunit 17 [Source:HGNC Symbol;Acc:2375]
Mouse Orthologue:
Med17
Mouse Description:
mediator complex subunit 17 Gene [Source:MGI Symbol;Acc:MGI:2182585]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16434 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16434
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008504 Essential Splice Site 80 561 1 13
Genomic Location:
Chromosome 15 (position 124020)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCAGAGCSGGCCGAGAGCAGTGGAAGCAGGAGCCWGAGGAGGACGAGGG[T/C]ACGATGATRATGATGAAGATGCCCACCAAGACATTTAGCATTTAGTAATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/m4il2qhp