mif4gdb

Ensembl ID:
ENSDARG00000006331
ZFIN ID:
ZDB-GENE-050227-7
Description:
MIF4G domain-containing protein B [Source:UniProtKB/Swiss-Prot;Acc:Q5EAQ1]
Human Orthologue:
MIF4GD
Human Description:
MIF4G domain containing [Source:HGNC Symbol;Acc:24030]
Mouse Orthologue:
Mif4gd
Mouse Description:
MIF4G domain containing Gene [Source:MGI Symbol;Acc:MGI:1916924]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37850 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37850
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005626 Nonsense 133 222 4 5
Genomic Location (Zv9):
Chromosome 24 (position 16755462)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 11114190
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCAACAACATGCCCATGGTGGCTCTGGTCCACCCGGTCTATGACTGTT[T/A]GTTCAGACTGGCCCAGTCAGATGCCCTGAAGAATGAAGAGGAGGTGAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link